The mitochondrial genome of Chaeturichthys stigmatias provides novel insight into the interspecific difference with Amblychaeturichthys hexanema

Jian Zheng Bingjie Chen Tianxiang Gao Na Song

Jian Zheng, Bingjie Chen, Tianxiang Gao, Na Song. The mitochondrial genome of Chaeturichthys stigmatias provides novel insight into the interspecific difference with Amblychaeturichthys hexanema[J]. Acta Oceanologica Sinica. doi: 10.1007/s13131-021-1787-1
Citation: Jian Zheng, Bingjie Chen, Tianxiang Gao, Na Song. The mitochondrial genome of Chaeturichthys stigmatias provides novel insight into the interspecific difference with Amblychaeturichthys hexanema[J]. Acta Oceanologica Sinica. doi: 10.1007/s13131-021-1787-1

doi: 10.1007/s13131-021-1787-1

The mitochondrial genome of Chaeturichthys stigmatias provides novel insight into the interspecific difference with Amblychaeturichthys hexanema

Funds: The National Key R&D Program of China under contract No. 2018YFD0900905; the National Natural Science Foundation of China under contract No. 41776171.
More Information
    • 关键词:
    •  / 
    •  / 
    •  / 
    •  
  • Figure  1.  Neighbor-joining tree for COI haplotypes of A. hexanema and C. stigmatias. Bootstrap values of >70% (out of 1 000 replicates) are shown on the nodes.

    Figure  2.  Neighbor-joining tree for 12S rRNA haplotypes of A. hexanema and C. stigmatias.

    Figure  3.  The gene map of the complete mitochondrial genome of C. stigmatias. Genes encoded on the H-strand and L-strand are shown outside and inside the circular map of the mitogenome, respectively.

    Figure  4.  The phylogenetic analyses investigated using Neighbor-Joining based on nucleotide sequences of 13 concatenated protein-coding genes. Cyprinus carpio (GenBank: KP993139) was used as an outgroup. The black box represented sequences of C. stigmatias sequenced in this study.

    Table  1.   The sampling information of C. stigmatias and A. hexanema

    SpeciesSampling siteSampling timeSample number/ind.Body length/mmWeight/g
    C. stigmatiasQingdaoDec. 20183094.75−196.174.4−39.4
    A. hexanemaQingdaoDec. 20182467.63−133.062.7−20.3
    下载: 导出CSV

    Table  2.   Genetic diversity parameters of C. stigmatias and A. hexanema based on COI gene

    ParameterA. hexanemaC. stigmatias
    Sample number/ind.2430
    Haplotypes number/ind. 711
    Haplotype diversity0.445 7±0.126 00.564 4±0.037 6
    Nucleotide diversity0.002 0±0.001 40.002 9±0.001 9
    下载: 导出CSV

    Table  3.   Genetic diversity parameters of C. stigmatias and A. hexanema based on 12S rRNA gene

    ParameterA. hexanemaC. stigmatias
    Sample number/ind.2430
    Haplotypes number/ind. 2 2
    Haplotype diversity0.507 2±0.044 50.516 9±0.031 4
    Nucleotide diversity0.002 6±0.002 60.002 7±0.002 6
    下载: 导出CSV

    Table  4.   Complete mitochondrial genome characteristics of C. stigmatias

    GeneStart position/bpStop position/bpSize/bpIntergenic nucleotideStart codonStop codonStrand
    tRNA-Phe168680H
    12S rRNA691 0179490H
    tRNA−Val1 0181 091740H
    16S rRNA1 0922 7741 6830H
    tRNA−Leu2 7752 847730H
    ND12 8483 8229753ATGTAAH
    tRNA−Ile3 8263 89570−1H
    tRNA−Gln3 8953 964701L
    tRNA−Met3 9664 033681H
    ND24 0355 0791 044−2ATGT − −H
    tRNA−Trp5 0785 149720H
    tRNA−Ala5 1505 221720L
    tRNA−Asn5 2225 295741L
    tRNA−Cys5 3275 390640L
    tRNA−Tyr5 3915 461713L
    COXI5 4657 0181 5540GTGTAAH
    tRNA−Ser7 0197 089713L
    tRNA−Asp7 0937 163712H
    COXII7 1667 8566911ATGT − −H
    tRNA−Lys7 8587 931740H
    ATP87 9328 096165−5ATGTAAH
    ATP68 0908 7736840ATGTAAH
    COXIII8 7749 5577840ATGT − −H
    tRNA−Gly9 5589 629720H
    ND39 6309 9783490ATGT − −H
    tRNA−Arg9 97910 046680H
    ND4L10 04710 3432970ATGTAAH
    ND410 34411 7241 3810ATGT − −H
    tRNA−His11 72511 79470−1H
    tRNA−Ser11 79411 861685H
    tRNA−Leu11 86711 939730H
    ND511 94013 7811 842−1ATGTAAH
    ND613 78114 7921 0120CTAT − −L
    tRNA−Glu14 79314 863710L
    Cyt b14 86416 0001 1375ATGTAAH
    tRNA−Thr16 00116 07272−1H
    tRNA−Pro16 07216 142710L
    D−loop16 14317 134992H
    Note: H, genes encoded on the H-strand; L, genes encoded on L-strand. −, no data.
    下载: 导出CSV

    A1.   Primers for complete mitochondrial genome of C. stigmatias

    Primer namePrimer sequence (5′-3′)Temperature /°CReference
    F: GTCGGTAAAACTCGTGCCAGC52Masaki et al., 2015
    MiFish-UR: CATAGTGGGGTATCTAATCCCAGTTTG
    F: AACCCTATTCACAGCAACAT48this study
    C1R: TGAGCAGTCCTAAGATAGTAAC
    F: GCCCTAACAACCCTATTCA52this study
    C2R: AAGGCGACGATGAAGATG
    F: GGTAAGGTTCTGCTGCTAA50this study
    C3R: ATCGGCGGTGTAGTGTAT
    F: GGTTTGAACTCAGATCATGT52Masaki et al., 2015
    16SR: GGTTTGAACTCAGATCATGT
    F: TGCGAGCATGATACCATAA52this study
    C4R: GATTATCATCCGCCTATGCTA
    F: CCAACATCTGAAGGTCCAC48this study
    C5R: GGTACGAAGATTAGCAGTCT
    F: TCCTTAATTGCCTACTCATCC48this study
    C6R: GGTACGAAGATTAGCAGTCT
    F: TAACAGGCATTGGCACTC52this study
    C7R: GTCAGCGAACTCAAGAATAG
    F: AGACTGCTAATCTTCGTACC54this study
    C8R: GTTTGCTGTGACAAGAATGA
    F: CACTTATAACCGCATGATGG50this study
    C9R: GGTACGAAGATTAGCAGTCT
    F: GCCACATAAGCCTCGTAG48this study
    C10R: CCATCAGCCAATGAGTAAGA
    F: TCAACCAACCACAAAGACATTGGCAC52Ward et al., 2008
    COIR: TAGACTTCTGGGTGGCCAAAGAATCA
    F: GCCACCAACCTTAACTCTT50this study
    C11R: ACTCCATCTCAAGCAATCAG
    F: GGCGACATCGGACTAATC48this study
    C12R: GGTATTGCTTGCTGTTGTT
    F: CACTGATTGCTTGAGATGG54this study
    C13R: TGCGAGGAATGTAGTTAGG
    F: CATAGGATAGCCATCAACCA52this study
    C14R: TGTCAGCGGTGTAGTGTA
    F: TAACAACAGCAAGCAATACC52this study
    C15R: AGAAAATGTGTCCACGAGTT
    F: GCAGTTTTACCAGCGAGC52this study
    C16R: GGCGATGTGTTGGGATGT
    F: ACTTCGGTTCAAAGGTCAT48this study
    C17R: GCCGATGTGTTGGGATGTT
    F: TTATGTTGAATAAGTTA48this study
    C18R: TATTACATAAAATTAACA
    F: TATTACATAAATTTAACTAT46this study
    C19R: TCGGTCTGTAAGAAGCATAG
    F: CTTCGGTTCAAAGGTCAT54this study
    C20R: GTAGTGGAGGTGAAGCGA
    F: CAGGTAAAGCACAGTAGAGT52this study
    C21R: CCTTTCATTTGGCATTTCAG
    F: TTACCAGCGAGCATCACCT52this study
    C22R: GTAGTGGAGGTGAAGCGAA
    F: TTTTACCAGCGAGCATCACC56this study
    C23R: GTAGTGGAGGTGAAGCGAAA
    F: AATCCAGGTCGGTTTCTATC50this study
    C24R: CTTGCTTGTGCGTGACTT
    F: CAGGTCGGTTTCTATCTATG48this study
    C25R: TCTTCGCCCTTATTATCG
    F: AGGTCGGTTTCTATCTATG52this study
    C26R: GTCCAGCCAAAGATAGATA
    F: TTATGTTGAATAAGTTAATAT48this study
    C27R: AGAAAATGTGTCCACGAGTT
    F: TATTACATAAAATTAACAATAA52this study
    C28R: GGCTACAATCCACCACTTA
    F: CAGCGGTTCTTCTACTCTT54this study
    C29R: TCCTGCGAATATAACTCCAA
    F: TCTCAACCACATTAACCGTA48this study
    C30R: CGTATAACAGCCTTGAAGATG
    F: CTGTAGAGTGAACGCTTGGCATG50this study
    C31R: CCCATCTCTAGCTCCCAAAGC
    F: GTGCGGATACTTGCATGTGT52this study
    下载: 导出CSV
  • [1] Boore J L. 2006. The use of genome-level characters for phylogenetic reconstruction. Trends in Ecology & Evolution, 21(8): 439–446
    [2] Burland T G. 2000. DNASTAR’s lasergene sequence analysis software. In: Misener S, Krawetz S A, eds. Bioinformatics Methods and Protocols. Totowa, NJ: Humana Press, 71–91
    [3] Chen Fenfang, Ma Hongyu, Ma Chunyan, et al. 2016. The complete mitochondrial genome sequence and gene organization of Amblychaeturichthys hexanema (Gobiidae: Amblychaeturichthys) with phylogenetic consideration. Mitochondrial DNA Part A, 27(6): 4687–4688. doi: 10.3109/19401736.2015.1106503
    [4] Cywinska A, Hunter F F, Hebert P D N. 2006. Identifying Canadian mosquito species through DNA barcodes. Medical and Veterinary Entomology, 20(4): 413–424. doi: 10.1111/j.1365-2915.2006.00653.x
    [5] East China Sea Fishery Research Institute of Chinese Academy of Fishery Sciences. 1990. The Fishes of Shanghai (in Chinese). Shanghai: Shanghai Scientific & Technical Publishers
    [6] Excoffier L, Laval G, Schneider S. 2005. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1: 47–50
    [7] Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39(4): 783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x
    [8] Gao Tianxiang, Ji Dongping, Xiao Yongshuang, et al. 2011. Description and DNA barcoding of a new Sillago species, Sillago sinica (Perciformes: Sillaginidae), from coastal waters of China. Zoological Studies, 50(2): 254–263
    [9] Guo Enmian, Liu Yuan, Liu Jing, et al. 2010. DNA barcoding discriminates Pampus minor (Liu et al., 1998) from Pampus species. Chinese Journal of Oceanology and Limnology, 28(6): 1266–1274. doi: 10.1007/s00343-010-9917-1
    [10] Han Dongyan, Xue Ying, Ji Yupeng, et al. 2013. Feeding ecology of Amblychaeturichthys hexanema in Jiaozhou Bay, China. Chinese Journal of Applied Ecology (in Chinese), 24(5): 1446–1452
    [11] Hebert P D N, Cywinska A, Ball S L, et al. 2003a. Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270(1512): 313–321. doi: 10.1098/rspb.2002.2218
    [12] Hebert P D N, Ratnasingham S, Dewaard J R. 2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society B: Biological Sciences, 270(Suppl 1): S96–S99
    [13] Inoue J G, Miya M, Tsukamoto K, et al. 2001. A mitogenomic perspective on the basal teleostean phylogeny: resolving higher-level relationships with longer DNA sequences. Molecular Phylogenetics and Evolution, 20(2): 275–285. doi: 10.1006/mpev.2001.0970
    [14] Jin Xiaoxiao, Wang Rixin, Xu Tianjun, et al. 2012. Complete mitochondrial genome of Oxuderces dentatus (Perciformes, Gobioidei). Mitochondrial DNA, 23(2): 142–144. doi: 10.3109/19401736.2012.660930
    [15] Lavoué S, Miya M, Saitoh K, Ishiguro N B, et al. 2007. Phylogenetic relationships among anchovies, sardines, herrings and their relatives (Clupeiformes), inferred from whole mitogenome sequences. Molecular Phylogenetics and Evolution, 43(3): 1096–1105. doi: 10.1016/j.ympev.2006.09.018
    [16] Li Yongzhen, Chen Guobao, Sun Dianrong. 2000. Analysis of the composition of fishes in the Pearl River estuarine waters. Journal of Fisheries of China (in Chinese), 24(4): 312–317
    [17] Liu Jinxian, Gao Tianxiang, Wu Shifang, et al. 2007. Pleistocene isolation in the Northwestern Pacific marginal seas and limited dispersal in a marine fish, Chelon haematocheilus (Temminck & Schlegel, 1845). Molecular Ecology, 16(2): 275–288
    [18] Liu Lianwei, Xu Qianghua, Chen Xinjun. 2012. Population genetic structure of Ommastrephes bartramii in the North Pacific Ocean based on the COI and Cytb gene sequences analysis. Journal of Fisheries of China (in Chinese), 36(11): 1675–1684. doi: 10.3724/SP.J.1231.2012.27955
    [19] Lu Zhichuang, Xu Shengyong, Song Na, et al. 2016. Analysis of the diet of finless porpoise (Neophocaena asiaeorientalis sunameri) based on prey morphological characters and DNA barcoding. Conservation Genetics Resources, 8(4): 523–531. doi: 10.1007/s12686-016-0575-2
    [20] Masaki M, Yukuto S, Fukunaga, et al. 2015. Analytical pipeline for DNA sequences amplified by mifish primers. Biological Journal of the Linnean Society, 73: 259–316
    [21] Mei Chun, Xu Binduo, Xue Ying, et al. 2010. Fish community structure and species diversity during autumn and winter in the central waters of Jiaozhou Bay. Journal of Fishery Sciences of China (in Chinese), 17(1): 110–118
    [22] Meng Kuankuan, Wang Jing, Zhang Chongliang, et al. 2017. The fishery biological characteristics of Chaeturichthys stigmatias in the Yellow River Estuary and its adjacent waters. Journal of Fishery Sciences of China (in Chinese), 24(5): 939–945. doi: 10.3724/SP.J.1118.2017.17083
    [23] Meusnier I, Singer G A C, Landry J F, et al. 2008. A universal DNA mini-barcode for biodiversity analysis. BMC Genomics, 9: 214. doi: 10.1186/1471-2164-9-214
    [24] Miya M, Satoh T P, Nishida M. 2005. The phylogenetic position of toadfishes (Order Batrachoidiformes) in the higher ray-finned fish as inferred from partitioned Bayesian analysis of 102 whole mitochondrial genome sequences. Biological Journal of the Linnean Society, 85(3): 289–306. doi: 10.1111/j.1095-8312.2005.00483.x
    [25] Miya M, Takeshima H, Endo H, et al. 2003. Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Molecular Phylogenetics and Evolution, 26(1): 121–138. doi: 10.1016/S1055-7903(02)00332-9
    [26] Nelson J S, Grande T C, Wilson M V H. 2006. Fishes of the World. 4th ed. New York: John Wiley and Sons, 601
    [27] Pfenninger M, Nowak C, Kley C, et al. 2007. Utility of DNA taxonomy and barcoding for the inference of larval community structure in morphologically cryptic Chironomus (Diptera) species. Molecular Ecology, 16(9): 1957–1968. doi: 10.1111/j.1365-294X.2006.03136.x
    [28] Puckridge M, Andreakis N, Appleyard S A, et al. 2013. Cryptic diversity in flathead fishes (Scorpaeniformes: Platycephalidae) across the Indo-West Pacific uncovered by DNA barcoding. Molecular Ecology Resources, 13(1): 32–42. doi: 10.1111/1755-0998.12022
    [29] Qu Liyan. 2018. Phylogenetic analysis of 28 species of gobies in the East China Sea based on morphology, barcode and nuclear genes (in Chinese) [dissertation]. Shanghai: Shanghai Ocean University
    [30] Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4): 406–425
    [31] Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: A Laboratory Manual. 2nd ed. Harbor, NY: Cold Spring Harbor Laboratory Press
    [32] Shokralla S, Hellberg R S, Handy S M, et al. 2015. A DNA mini-barcoding system for authentication of processed fish products. Scientific Reports, 5: 15894. doi: 10.1038/srep15894
    [33] Smith P J, McVeagh S M, Steinke D. 2008. DNA barcoding for the identification of smoked fish products. Journal of Fish Biology, 72(2): 464–471. doi: 10.1111/j.1095-8649.2007.01745.x
    [34] Stoeckle M. 2003. Taxonomy, DNA, and the barcode of life. Bioscience, 53(9): 796–797. doi: 10.1641/0006-3568(2003)053[0796:TDATBC]2.0.CO;2
    [35] Suh K I, Hwang J M, Bae Y J, et al. 2019. Comprehensive DNA barcodes for species identification and discovery of cryptic diversity in mayfly larvae from South Korea: implications for freshwater ecosystem biomonitoring. Entomological Research, 49(1): 46–54. doi: 10.1111/1748-5967.12334
    [36] Sun Yuena, Wang Tao, Jin Xiaoxiao. 2015. Unusual features of control region and a novel NADH 6 genes in mitochondrial genome of the finespot goby, Chaeturichthys stigmatias (Perciformes, Gobiidae). Mitochondrial DNA, 26(5): 665–667. doi: 10.3109/19401736.2013.840598
    [37] Sun Peng, Yin Fei, Shi Zhaohong, et al. 2012. Phylogenetic relationships and population structure of Pampus in the South China Sea inferred from COI gene segments. Marine Sciences (in Chinese), 36(6): 15–21
    [38] Tamura K, Peterson D, Peterson N, et al. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28(10): 2731–2739. doi: 10.1093/molbev/msr121
    [39] Wang Lijuan, Wu Zhihao, Liu Mengxia, et al. 2018. DNA barcoding of marine fish species from Rongcheng Bay, China. PeerJ, 6: e5013. doi: 10.7717/peerj.5013
    [40] Ward R D, Holmes B H, Yearsley G K. 2008. DNA barcoding reveals a likely second species of Asian sea bass (barramundi) (Lates calcarifer). Journal of Fish Biology, 72(2): 458–463. doi: 10.1111/j.1095-8649.2007.01703.x
    [41] Ward R D, Zemlak T S, Innes B H, et al. 2005. DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences, 360(1462): 1847–1857. doi: 10.1098/rstb.2005.1716
    [42] Wu Hanlin, Zhong Junsheng. 2008. Fauna Sinica, Osfichthyes, Perciformes (V), Gobioidei. Beijing: Sdence Press, 211–215
    [43] Wyman S K, Jansen R K, Boore J L. 2004. Automatic annotation of organellar genomes with DOGMA. Bioinformatics, 20(17): 3252–3255. doi: 10.1093/bioinformatics/bth352
    [44] Xing Bingpeng, Lin Heshan, Zhang Zhilan, et al. 2018. DNA barcoding for identification of fish species in the Taiwan Strait. PLoS One, 13(6): e0198109. doi: 10.1371/journal.pone.0198109
    [45] Yu Xin. 2014. Methodology and case studies of fish otolith morphology and microchemistry analysis in stock discrimination (in Chinese) [dissertation]. Qingdao: Institute of Oceanography of Chinese Academy of Sciences
    [46] Zemlak T S, Ward R D, Connell A D, et al. 2009. DNA barcoding reveals overlooked marine fishes. Molecular Ecology Resources, 9(S1): 237–242
  • 加载中
图(4) / 表(5)
计量
  • 文章访问数:  44
  • HTML全文浏览量:  12
  • PDF下载量:  3
  • 被引次数: 0
出版历程
  • 收稿日期:  2020-06-17
  • 录用日期:  2020-08-24
  • 网络出版日期:  2021-07-23

目录

    /

    返回文章
    返回