Turn off MathJax
Article Contents

Feng Liu, XiaoKang Lv, TianQi Chu, Mengjie Wang, Wei Zhan, Bao Lou. Characterization of ghrelin mRNA expression in fasting Larimichthys crocea juveniles[J]. Acta Oceanologica Sinica.
Citation: Feng Liu, XiaoKang Lv, TianQi Chu, Mengjie Wang, Wei Zhan, Bao Lou. Characterization of ghrelin mRNA expression in fasting Larimichthys crocea juveniles[J]. Acta Oceanologica Sinica.

Characterization of ghrelin mRNA expression in fasting Larimichthys crocea juveniles

Funds:  The Special Fund for the key research and development project of Zhejiang Province under contract Nos. 2016C02055-7 and 2017C02013.
More Information
  • Larimichthys crocea is a marine fish species cultured in China. Short-term starvation is often applied to improve the quality of cultured L. crocea, and we studied the expression of ghrelin in tissues of stomach, muscle, brain, intestines, liver, and kidney, involved in starvation response, under starvation conditions to understand the effect of starvation on the expression of ghrelin in L. crocea juveniles. We found that ghrelin expression was tissue-specific and expression was significantly higher in the stomach compared to other tissues (P<0.01). Additionally, ghrelin expression in different tissues changed along with prolongation of fasting. In the stomach, ghrelin expression levels increased gradually at the beginning of the fast, and then declined after eight days of fasting. Gene expression in the brain and intestines increased at the beginning of the fast, and then decreased with longer fasting time. Interestingly, ghrelin expression declined at the beginning of the fast, then increased with longer fasting in the kidneys and muscles. These results suggest that ghrelin is involved in starvation response in L. crocea juveniles. This study provided insights into ghrelin function, and provided an important reference for the development of reasonable feeding strategies for L. crocea juveniles.
  • 加载中
  • [1] Amole N, Unniappan S. 2009. Fasting induces preproghrelin mRNA expression in the brain and gut of zebrafish, Danio rerio. General and Comparative Endocrinology, 161(1): 133–137. doi:  10.1016/j.ygcen.2008.11.002
    [2] Arvat E, Di Vito L, Broglio F, et al. 2000. Preliminary evidence that Ghrelin, the natural GH secretagogue (GHS)-receptor ligand, strongly stimulates GH secretion in humans. Journal of Endocrinological Investigation, 23(8): 493–495. doi:  10.1007/bf03343763
    [3] Cui Wentao. 2013. Cloning and distribution of three kinds of gastrointestinal peptide cDNAs in large yellow croaker (Pseudosciaena crocea) (in Chinese) [dissertation]. Zhoushan: Zhejiang Ocean University
    [4] Diéguez C, da Boit K, Novelle M G, et al. 2010. New insights in ghrelin orexigenic effect. Frontiers of Hormone Research, 38: 196–205. doi:  10.1159/000318511
    [5] Feng Ke, Zhang Guirong, Wei Kaijian, et al. 2013. Molecular cloning, tissue distribution, and ontogenetic expression of ghrelin and regulation of expression by fasting and refeeding in the grass carp (Ctenopharyngodon idellus). Journal of Experimental Zoology Part A: Ecological & Integrative Physiology, 319(4): 202–212. doi:  10.1002/jez.1784
    [6] Feng Zhaoxin. 1979. Ichthyology (in Chinese). Beijing: Agricultural Press House, 217
    [7] Fox B K, Breves J P, Hirano T, et al. 2009. Effects of short- and long-term fasting on plasma and stomach ghrelin, and the growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Domestic Animal Endocrinology, 37(1): 1–11. doi:  10.1016/j.domaniend.2009.01.001
    [8] Gao Fengying, Wang Huan, Lu Maixin, et al. 2010. cDNA cloning and expression characterization of ghrelin of Zanzibar tilapia, Oreochromis hornorum. Journal of Huazhong Agricultural University (in Chinese), 29(6): 752–757
    [9] Ginés R, Palicio M, Zamorano M J, et al. 2002. Starvation before slaughtering as a tool to keep freshness attributes in gilthead sea bream (Sparus aurata). Aquaculture International, 10(5): 379–389. doi:  10.1023/A:1023365025292
    [10] Heijboer A C, van den Hoek A M, Parlevliet E T, et al. 2006. Ghrelin differentially affects hepatic and peripheral insulin sensitivity in mice. Diabetologia, 49(4): 732–738. doi:  10.1007/s00125–006-0138–2
    [11] Hosoda H, Kojima M, Matsuo H, et al. 2000. Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochemical and Biophysical Research Communications, 279(3): 909–913. doi:  10.1006/bbrc.2000.4039
    [12] Jönsson E. 2013. The role of ghrelin in energy balance regulation in fish. General and Comparative Endocrinology, 187: 79–85. doi:  10.1016/j.ygcen.2013.03.013
    [13] Kaiya H, Kojima M, Hosoda H, et al. 2003a. Peptide purification, complementary deoxyribonucleic acid (DNA) and genomic DNA cloning, and functional characterization of ghrelin in rainbow trout. Endocrinology, 144(12): 5215–5226. doi:  10.1210/en.2003–1085
    [14] Kaiya H, Kojima M, Hosoda H, et al. 2003b. Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel and its biological activity. Journal of Endocrinology, 176(3): 415–423. doi:  10.1677/joe.0.1760415
    [15] Kaiya H, Kojima M, Hosoda H, et al. 2003c. Identification of tilapia ghrelin and its effects on growth hormone and prolactin release in the tilapia, Oreochromis mossambicus. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 135(3): 421–429. doi:  10.1016/s1096–4959(03)00109-x
    [16] Kaiya H, Small B C, Bilodeau A L, et al. 2005. Purification, cDNA cloning, and characterization of ghrelin in channel catfish, Ictalurus punctatus. General and Comparative Endocrinology, 143(3): 201–210. doi:  10.1016/j.ygcen.2005.03.012
    [17] Karapanagiotou E M, Polyzos A, Dilana K D, et al. 2009. Increased serum levels of ghrelin at diagnosis mediate body weight loss in non-small cell lung cancer (NSCLC) patients. Lung Cancer, 66(3): 393–398. doi:  10.1016/j.lungcan.2009.02.006
    [18] Kojima M, Hosoda H, Date Y, et al. 1999. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature, 402(6762): 656–660. doi:  10.1038/45230
    [19] Kono T, Kitao Y, Sonoda K, et al. 2008. Identification and expression analysis of ghrelin gene in common carp Cyprinus carpio. Fisheries Science, 74(3): 603–612. doi:  10.1111/j.1444–2906.2008.01564.x
    [20] Li Wenjie, Ai Qinghui, Mai Kangsen, et al. 2013. Effects of dietary amino acid patterns on growth and protein metabolism of large yellow croaker (Larimichthys crocea) larvae. Aquaculture, 406–407: 1–8. doi:  10.1016/j.aquaculture.2013.04.029
    [21] Ma Xilan, Zhang Yong, Liu Yun, et al. 2009. Effect of different fasting stages on ghrelin expression in Black Sea Bream, Acanthopagrus schlegeli. Oceanologia et Limnologia Sinica (in Chinese), 40(3): 313–318
    [22] Murashita K, Kurokawa T, Nilsen T O, et al. 2009. Ghrelin, cholecystokinin, and peptide YY in Atlantic salmon (Salmo salar): molecular cloning and tissue expression. General and Comparative Endocrinology, 160(3): 223–235. doi:  10.1016/j.ygcen.2008.11.024
    [23] Olsson C, Holbrook J D, Bompadre G, et al. 2008. Identification of genes for the ghrelin and motilin receptors and a novel related gene in fish, and stimulation of intestinal motility in zebrafish (Danio rerio) by ghrelin and motilin. General and Comparative Endocrinology, 155(1): 217–226. doi:  10.1016/j.ygcen.2007.05.016
    [24] Parhar I S, Sato H, Sakuma Y. 2003. Ghrelin gene in cichlid fish is modulated by sex and development. Biochemical and Biophysical Research Communications, 305(1): 169–175. doi:  10.1016/s0006–291x(03)00729–0
    [25] Peddu S C, Breves J P, Kaiya H, et al. 2009. Pre- and postprandial effects on ghrelin signaling in the brain and on the GH/IGF-I axis in the Mozambique tilapia (Oreochromis mossambicus). General and Comparative Endocrinology, 161(3): 412–418. doi:  10.1016/j.ygcen.2009.02.008
    [26] Pusztai P, Sarman B, Ruzicska E, et al. 2008. Ghrelin: a new peptide regulating the neurohormonal system, energy homeostasis and glucose metabolism. Diabetes/Metabolism Research and Reviews, 24(5): 343–352. doi:  10.1002/dmrr.830
    [27] Riley L G, Fox B K, Breves J P, et al. 2008. Absence of effects of short-term fasting on plasma ghrelin and brain expression of ghrelin receptors in the Tilapia, Oreochromis mossambicus. Zoological Science, 25(8): 821–827. doi:  10.2108/zsj.25.821
    [28] Terova G, Rimoldi S, Bernardini G, et al. 2008. Sea bass ghrelin: molecular cloning and mRNA quantification during fasting and refeeding. General and Comparative Endocrinology, 155(2): 341–351. doi:  10.1016/j.ygcen.2007.05.028
    [29] Thakur D P, Morioka K, Itoh Y, et al. 2003. Lipid composition and deposition of cultured yellowtail Seriola quinqueradiata muscle at different anatomical locations in relation to meat texture. Fisheries Science, 69(3): 487–494. doi:  10.1046/j.1444–2906.2003.00649.x
    [30] Unniappan S, Canosa L F, Peter R E. 2004. Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology, 79(2): 100–108. doi:  10.1159/000076634
    [31] Volkoff H. 2015. Cloning, tissue distribution and effects of fasting on mRNA expression levels of leptin and ghrelin in red-bellied piranha (Pygocentrus nattereri). General and Comparative Endocrinology, 217–218: 20–27. doi:  10.1016/j.ygcen.2015.05.004
    [32] Volkoff H, Peter R E. 2006. Feeding behavior of fish and its control. Zebrafish, 3(2): 131–140. doi:  10.1089/zeb.2006.3.131
    [33] Wang Le, Shi Xiaofeng, Su Yongquan, et al. 2012. Loss of genetic diversity in the cultured stocks of the large yellow croaker, Larimichthys crocea, revealed by microsatellites. International Journal of Molecular Sciences, 13(5): 5584–5597. doi:  10.3390/ijms13055584
    [34] Wang Qianfeng, Shen Weiliang, Liu Cheng, et al. 2017. Effects of multi-environmental factors on physiological and biochemical responses of large yellow croaker, Larimichthys crocea. Chemosphere, 184: 907–915. doi:  10.1016/j.chemosphere.2017.06.043
    [35] Wren A M, Bloom S R. 2007. Gut hormones and appetite control. Gastroenterology, 132(6): 2116–2130. doi:  10.1053/j.gastro.2007.03.048
    [36] Wren A M, Small C J, Ward H L, et al. 2000. The novel hypothalamic peptide Ghrelin stimulates food intake and growth hormone secretion. Endocrinology, 141(11): 4325–4328. doi:  10.1210/endo.141.11.7873
    [37] Xing Shujuan, Sun Ruijian, Pan Xiaoyi, et al. 2016. Effects of dietary carbohydrate-to-lipid ratio on growth performance, body composition, digestive enzyme activities, and hepatic enzyme activities in juvenile large yellow croaker, Larimichthys crocea. Journal of the World Aquaculture Society, 47(2): 297–307. doi:  10.1111/jwas.12259
    [38] Xu Meiyu, Volkoff H. 2009. Molecular characterization of ghrelin and gastrin-releasing peptide in Atlantic cod (Gadus morhua): Cloning, localization, developmental profile and role in food intake regulation. General and Comparative Endocrinology, 160(3): 250–258. doi:  10.1016/j.ygcen.2008.12.004
    [39] Ye Hua, Liu Yang, Liu Xiande, et al. 2014. Genetic mapping and QTL analysis of growth traits in the large yellow croaker Larimichthys crocea. Marine Biotechnology, 16(6): 729–738. doi:  10.1007/s10126–014-9590-z
    [40] Yeung C M, Chan C B, Woo N Y, et al. 2006. Seabream ghrelin: cDNA cloning, genomic organization and promoter studies. Journal of Endocrinology, 189(2): 365–379. doi:  10.1677/joe.1.06593
    [41] Zhang Hanle, Sun Ruijian, Xu Wei, et al. 2016a. Dietary manganese requirement of juvenile large yellow croaker Larimichthys crocea (Richardson, 1846). Aquaculture, 450: 74–79. doi:  10.1016/j.aquaculture.2015.07.010
    [42] Zhang Zhenyu, Wang Qiurong, Ye Kun, et al. 2016b. Effect of fasting on body composition, muscle fatty acid profiles and serum biochemical parameters of large yellow croaker (Larimichthys crocea). Journal of Fisheries of China (in Chinese), 40(9): 1440–1450
    [43] Zhou Chaowei, Zhang Xingdong, Liu Tao, et al. 2014. Schizothorax davidi ghrelin: cDNA cloning, tissue distribution and indication for its stimulatory character in food intake. Gene, 534(1): 72–77. doi:  10.1016/j.gene.2013.10
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(4)  / Tables(1)

Article Metrics

Article views(58) PDF downloads(0) Cited by()

Related
Proportional views

Characterization of ghrelin mRNA expression in fasting Larimichthys crocea juveniles

Funds:  The Special Fund for the key research and development project of Zhejiang Province under contract Nos. 2016C02055-7 and 2017C02013.

Abstract: Larimichthys crocea is a marine fish species cultured in China. Short-term starvation is often applied to improve the quality of cultured L. crocea, and we studied the expression of ghrelin in tissues of stomach, muscle, brain, intestines, liver, and kidney, involved in starvation response, under starvation conditions to understand the effect of starvation on the expression of ghrelin in L. crocea juveniles. We found that ghrelin expression was tissue-specific and expression was significantly higher in the stomach compared to other tissues (P<0.01). Additionally, ghrelin expression in different tissues changed along with prolongation of fasting. In the stomach, ghrelin expression levels increased gradually at the beginning of the fast, and then declined after eight days of fasting. Gene expression in the brain and intestines increased at the beginning of the fast, and then decreased with longer fasting time. Interestingly, ghrelin expression declined at the beginning of the fast, then increased with longer fasting in the kidneys and muscles. These results suggest that ghrelin is involved in starvation response in L. crocea juveniles. This study provided insights into ghrelin function, and provided an important reference for the development of reasonable feeding strategies for L. crocea juveniles.

Feng Liu, XiaoKang Lv, TianQi Chu, Mengjie Wang, Wei Zhan, Bao Lou. Characterization of ghrelin mRNA expression in fasting Larimichthys crocea juveniles[J]. Acta Oceanologica Sinica.
Citation: Feng Liu, XiaoKang Lv, TianQi Chu, Mengjie Wang, Wei Zhan, Bao Lou. Characterization of ghrelin mRNA expression in fasting Larimichthys crocea juveniles[J]. Acta Oceanologica Sinica.
    • Ghrelin is an endogenous ligand for the growth hormone secretagogue receptor (GHS-R) that is involved in promoting growth hormone (GH) release (Kojima et al., 1999; Arvat et al., 2000; Fox et al., 2009), controlling appetite (Wren et al., 2000; Karapanagiotou et al., 2009), and regulating energy metabolism (Diéguez et al., 2010; Pusztai et al., 2008; Wren and Bloom, 2007; Heijboer et al., 2006). In fish, ghrelin was first cloned in Carassius auratus, followed by Oreochromis niloticus (Kaiya et al., 2003c), Ictalurus punctatus (Kaiya et al., 2005), Acanthopagrus schlegeli (Yeung et al., 2006), Danio rerio (Olsson et al., 2008) and Gadus morhua (Xu and Volkoff, 2009). Fish grown in culture conditions change their feeding patterns based on growth stage, photoperiod, culture density, food distribution or culture environment (Volkoff and Peter, 2006). Fish experiencing starvation stress show changes in physiology and gene expression. Starvation leads to changes in fish ghrelin expression. For example, D. rerio (Amole and Unniappan, 2009), goldfish (Unniappan et al., 2004), Ctenopharyngodon idellus (Feng et al., 2013) and Schizothorax davidi (Zhou et al., 2014) deprived of food have increased ghrelin expression in the intestine, and Salmo salar (Murashita et al., 2009) and O. mossambicus (Peddu et al., 2009) under starvation conditions have significantly up-regulated ghrelin in the stomach.

      Larimichthys crocea is a marine fish endemic to the South China Sea, East China Sea and Yellow Sea (Feng, 1979), and is one of the major species cultured in China. This fish is widely cultured throughout the coastal areas of Zhejiang and Fujian province, and the farming is a rapidly growing industry. As a result of long-term, high-intensity stocking and unscientific breeding management, the quality of L. crocea has been decreased significantly. This has resulted in a decrease in market value of L. crocea, affecting the healthy development of the aquaculture industry in this species. Currently, there are active efforts to improve the quality of L. crocea, such as regulating the nutrient composition of the feed (Xing et al., 2016; Zhang et al., 2016a; Li et al., 2013), changing culture patterns (Wang et al., 2017), and breeding improved varieties (Wang et al., 2012; Ye et al., 2014). In addition to these, a popular strategy has been to induce short-term starvation stress to reduce the amount of fat in the abdominal cavity, which improves the quality of the fish for human consumption by decreasing the fattiness (Ginés et al., 2002; Thakur et al., 2003). This method has been widely used in some fish culture systems and resulted in improvement of the quality of cultured fish. Without exception, this method of short-term starvation stress improves the quality of L. crocea.

      As mentioned above, starvation will lead to changes of ghrelin expression in fish. However, the effect of starvation stress on the expression of ghrelin, which regulates growth and feeding of juvenile L. crocea, has not been reported, although starvation stress alters the muscle fat composition and serum parameters of adult L. crocea (Zhang et al., 2016b).To this end, we studied ghrelin mRNA expression in the muscle, liver, intestine, stomach, kidney and brain of L. crocea juveniles after placing them in fasting condition for 0 d, 4 d, 8 d, 12 d, 16 d, and 20 d. The changes of the gene expression according to fasting times were analyzed to develop a reasonable feeding strategy for culturing juvenile L. crocea.

    • The experiment was carried out on Xishan Island in Zhoushan (Zhejiang, China), and 540 healthy L. crocea juveniles with an initial average individual body weight of 40.59 ± 1.79 g were obtained from the Dengbu Aquatic Company located in Zhoushan. Fish were randomly divided into six groups, with three parallel groups per condition, and acclimated to laboratory condition in 18 cylindrical fiberglass tanks (0.5 m3) with 30 fish in each tank. Fish were acclimated for seven days prior to the experiment under flow-through sand-filtered seawater conditions. During acclimation, the fish were fed twice daily at 08:00 AM and 04:00 PM to satiation with an artificial formulated diet. The seawater conditions during acclimatization were as follows: pH, 7.7–8.5, salinity, 27.0–29.0, temperature, 25–27°C, dissolved oxygen > 5.5 mg L–1. The filth at the bottom of the tank was removed by siphoning, and about 70 % of the water was exchanged after half an hour of feeding.

      Following the acclimation period, the six groups were treated with fasting for 0 d (control group), 4 d, 8 d, 12 d, 16 d, and 20 d, and the control group continued to be fed twice daily. Once fish were fasted to the assigned length of time, 9 fish from each group (three fish from each parallel experiment) were sacrificed at 7:00 AM. At the time of sampling, the animals were netted and anesthetized using 100 mg/l of MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Sigma Aldrich Co., St. Louis, USA), and the back muscle, liver, intestine, stomach, kidney and brain tissue of each fish were collected and stored in RNAlater at −80°C. The control group was sampled at the same time the target treatment groups were sampled.

    • Total RNA from each tissue was extracted from tissues using the TransZol Up kit (TransGen Biotech, China) following the manufacturers’ protocol. Final RNA concentrations were determined by optical density reading at 260 nm using a NanoDrop 2000c spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA). To ensure that RNA samples were of high quality, only RNA samples with the absorbance ratio of 1.8 to 2.0 for 260 and 280 nm were used.

      First-strand cDNA was synthesized from 1 μg total RNA using a TransScript All-in-One First-Strand cDNA Synthesis SuperMix (One-Step gDNA Removal) kit (TransGen Biotech, China) following the manufacturer’s protocol.

    • cDNA sequence of ghrelin was obtained from GenBank (NM_001303331.1). The cDNA sequence similarity analysis was performed by the BLAST from the National Centre for Biotechnology Information (NCBI) website (www.ncbi.nlm.nih.gov). Protein structure was predicted by SMART (http://smart.embl-heidelberg.de/). Multiple sequence alignment of amino acid sequences was performed using the ClustalX program (http://www.ebi.ac.uk/clustaw/). Phylogenetic tree was reconstructed by MEGA software version 5.0 using the neighbor-joining method.

    • Primers for ghrelin and a house-keeping gene β-actin were designed based on GenBank sequences (NM_001303331.1 and XM_019257255.1) and synthesized by Genewiz biotechnology Co., Ltd (China). Primer sequences are shown in Table 1. Real-time qPCR was conducted as follows: 10 μL of 2×TransStart Tip Green qPCR SuperMix, 0.4 μL (10 μM) of forward and 0.4 μL (10 μM) of reverse primer, 0.4 μL of Passive Reference DyeI, 6.8 μL of ddH2O, and 2 μL of cDNA with a final reaction volume of 20 μL. Reactions were conducted in 96-well plates and samples were run in triplicate. PCR reaction was carried out on a Stepone Real-Time PCR System (ABI, American) using the following thermal cycling program: 94°C for 30 s, 40 cycles of 94°C for 5 s, 60°C for 30 s.

      GenePrimer nameSequence (5′-3′)Product length/bp
      ghrelinGhrelin_FCTTCCTCAGCCCTTCACAAA198
      Ghrelin_RAGACGCTGAATGATCTCCTG
      β-actinβ-actin_FCCAACTCATTGGCATGGCTT134
      β-actin_RGATGCAACTGCAGAACCCTG

      Table 1.  List of PCR primers used in this study.

      Real time qPCR measurements were displayed as threshold cycle (CT) values and used to calculate ΔCT. Gene expression levels were measured as a relative to β- actin expression levels, and 2–ΔΔCT was used to determine the relative level of ghrelin mRNA expression.

    • The results of the fasting experiments are represented as mean ± SEM (n=9). Data were analyzed using SPSS 19.0 (IBM Corp., Armonk, NY, USA). One-way ANOVA was used to examine the differences among the values obtained from the fasting experiment, followed by post hoc analysis using Tukey’s multiple range tests. Differences were considered significant when P value < 0.05.

    • A ghrelin cDNA fragment of 327 bp was obtained from GenBank. The alignment of the ghrelin amino-acid sequence of L. crocea and other fish are shown in Fig. 1. The amino-acid sequence of ghrelin of L. crocea showed low identity with the other fish (40–80%). The construction of a phylogenetic tree was based on ghrelin amino-acid sequences of L. crocea and other vertebrate. Phylogenetic tree analysis indicated that L. crocea was in the same subgroup with other fishes and had the closest phylogenetic relationship with Epinephelus coioides, and Siniperca chuatsi (Fig. 2).

      Figure 1.  Multiple alignment of ghrelin amino acid sequences. The comparison includes ghrelin sequences from the teleost species O. mykiss (BAD02980.1), S. salar (NP_001133057.1), L. crocea (NP_001290260.1), E. coioides (AJS13600.1), S. chuatsi (ALB25888.1), D. labrax (ABG49130.1), A. schlegelii (AAV65509.1), O. mossambicus (BAC55160.1), S. richardsonii (AWB11399.1), M. piceus (AIZ50369.1), D. rerio (ACJ76436.1). Identical amino acids are highlighted in black, strongly similar amino acids are printed in white letters with dark gray underline.

      Figure 2.  Phylogenetic trees analysis based on ghrelin amino sequences. GenBank Accession numbers of sequences used are R. norvegicus (BAA89370.1), M. mulatta (AAQ74381.1), H. sapiens (ADM33790.1), G. gallus (AAP57945.1), X. laevis (BAL70270.1), C. pyrrhogaster (BAM29300.1), S. richardsonii (AWB11399.1), M. piceus (AIZ50369.1), D. rerio (ACJ76436.1), T. fulvidraco (ALK82256.1), O. mykiss (BAD02980.1), S. salar (NP_001133057.1), O. mossambicus (BAC55160.1), L. crocea (NP_001290260.1), E. coioides (AJS13600.1), S. chuatsi (ALB25888.1), D. labrax (ABG49130.1), A. schlegelii (AAV65509.1). The scale bar is 0.05.

    • ghrelin mRNA expression was detected in the six tissues obtained from the experiment groups, which included stomach, kidney, liver, brain, intestine, and muscle. Expression levels of all tissues are expressed relative to the brain (Fig. 3). It is showed that ghrelin expression was highest in the stomach followed by muscle, and lowest expression was found in the kidney. Also, the expression levels of the kidney, liver, brain, and intestine were not different significantly.

      Figure 3.  Expression of ghrelin mRNA in different tissues of L. crocea juvelines. Expression levels of all tissues are expressed relative to the brain. Data are shown as mean ± SEM (n=9). Significant differences are indicated with different lowercase letters above the vertical bars (P <0.05).

    • We found that ghrelin expression levels were different in each tissue, and that fasting induced significant and tissue-specific changes in ghrelin expression in the different fasting-treated groups (P<0.05). In addition to this, gene expression changed with increased time of fasting. In the stomach, ghrelin levels first increased then decreased with the prolongation of fasting, reaching highest expression level at eight days of fasting (Fig. 4A). In contrast, muscle (Fig. 4B) and kidney (Fig. 4F) showed down-regulation of ghrelin at the beginning of fasting and an up-regulation with prolonged fasting. The lowest ghrelin expressions in the two tissues were observed at 12 days of fasting. In the kidney, ghrelin expression in fasting individuals was consistently lower than the control. Those in the brain (Fig. 4C) and intestine (Fig. 4D) showed increased ghrelin expression with highest levels reaching at four days of fasting, followed by a decrease in expression. Interestingly, ghrelin levels increased again with longer fasting. Lastly, the expression patterns of ghrelin in the liver showed fluctuating with prolonged fasting time, where highest expression was observed at 12 days of fasting, and lowest expression level was observed at eight days of fasting (Fig. 4E).

      Figure 4.  Relative expression level of ghrelin in tissues of L. crocea juveniles treated with different lengths of fasting for (A) stomach, (B) muscle, (C) brain, (D) intestine, (E) liver, and (F) kidney. Expression levels were normalized as the average expression levels of the treatment group where the expression levels the control group (0 d) were set as 1. Data are shown as mean ± SEM (n=9). Significant differences are indicated with different lowercase letters above the vertical bars (P<0.05).

    • In order to investigate the effects of fasting on the mRNA expression of ghrelin in L. crocea, we extracted the complete cDNA sequence of ghrelin from GenBank at first. And then, an analysis of amino acid sequence of ghrelin was carried out. The results showed that the L. crocea ghrelin presented most similarities with that in E. coioides. Following the sequence analysis, we examined the expressions of ghrelin mRNA in muscle, liver, intestine, stomach, kidney and brain of L. crocea juveniles using real-time qPCR. We found that ghrelin was expressed in all six tissues, which was different from studies focusing on other fish species. In Cyprinus carpio, ghrelin expression is highest in the intestine and lowest in the spleen and brain, and ghrelin expression is non-detectable in sputum, liver, kidney and muscle tissues (Kono et al., 2008).This indicates that the tissues-specific expression pattern of ghrelin depends on the species. We also found that ghrelin expression was highest in the stomach, and similar results were observed in A. schlegeli (Ma et al., 2009), Oncorhynchus mykiss (Kaiya et al., 2003a), I. punctatus (Kaiya et al., 2005), Anguilla japonica (Kaiya et al., 2003b), G. morhua (Xu and Volkoff, 2009), and O. niloticus (Parhar et al., 2003). The second highest expression of ghrelin was found in the muscle, which is quite different from goldfish (Pusztai et al., 2008) and Pygocentrus nattereri (Volkoff, 2015), but consistent with O. hornorum (Gao et al., 2010), suggesting that there are some similar patterns in relative expression levels of ghrelin in different fish species.

      We found that ghrelin expression was highest in the stomach, followed by muscle, brain, intestine, liver and kidney. A previous report by Cui (2013) reported that in adult L. crocea, ghrelin expression is highest in the stomach, followed by intestine, brain, liver and muscle. The most notable difference between adult and juvenile expression patterns is the expression level in muscle. This may be due to the rapid growth of L. crocea juveniles, as ghrelin expression can induce growth. L. crocea adults grow slowly, which may underlie the reduced ghrelin expression level in the adult muscle. Also, we think the function of ghrelin may be different between the juveniles and adults, thus resulting in the difference in gene expression.

      As an important regulator of food intake, ghrelin can enhance the sense of hunger before feeding and induce feeding behavior (Hosoda et al., 2000). According to this theory, it is speculated that the expression level of ghrelin in L. crocea increases before feeding or after a short-term starvation. We found that ghrelin expression levels in the stomach and intestine were significantly increased after four days of fasting, suggesting that ghrelin may regulate feeding of L. crocea juveniles. Similar results have been reported in other animals. For example, Dicentrarchus labrax that was starved for five weeks had significantly higher ghrelin expression in the stomach (Terova et al., 2008), P. nattereri (Volkoff, 2015) and goldfish (Feng et al., 2013) fasted for seven days had significantly higher ghrelin levels in the intestine. We found that ghrelin expression in the stomach gradually decreased after eight days of fasting. In the intestine, ghrelin levels initially increased and then gradually declined, reaching the lowest level at 16 d of fasting. This may have been caused by the change in physiology between short-term and long-term fasting, as long-term fasting leads to burning more proteins as energy source to maintain basic physiological activities, thereby inhibiting the synthesis unnecessary proteins. Therefore, the decrease in ghrelin expression may be a result of the reduced metabolic activity and energy expenditure of long-term fasting individuals (Kono et al., 2008).

      The expression level of ghrelin in the brain increased at the beginning of fasting, then decreased, and lastly slowly increased as animals experienced prolonged fasting, and the results were similar to those in O. mossambicus (Riley et al., 2008), where expression of ghrelin mRNA was elevated in fasted O. mossambicus on day 3 and reduced on day 5, and then elevated again on day 7. The reason for this change is unclear. We speculate that the fluctuation result from the reduction in plasma Ghrelin content caused by starvation stress, therefore ghrelin mRNA expression increases under the regulation of the body itself to restore plasma Ghrelin to induce food intake. However, prolonged fasting may lead to a decline in energy used for body growth, leading to reduced production of growth hormones by reducing ghrelin expression. Since ghrelin has multiple functions in the body, the long-term low level of ghrelin expression leads to the continuous decline of ghrelin content in the hypothalamus, thus affecting the normal physiological function (Jönsson, 2013). This may further lead to promoting ghrelin expression through self-regulation.

      ghrelin mRNA expression has been detected in the muscle, liver and kidney of P. nattereri (Riley et al., 2008), A. japonica (Kaiya et al., 2003b), and O. mossambicus (Kaiya et al., 2003c). Interestingly, changes in ghrelin expression levels have not been reported in the liver, kidney and muscle under starvation conditions. We found that ghrelin expression in these tissues changed as animals experienced short and long term fasting. However, the reasons for the changes in ghrelin expression at different fasting time points need to be further studied in the context of ghrelin function in these three tissues.

      Taken together, we found that ghrelin mRNA levels in L. crocea juveniles were higher in the stomach and intestine at 4-8 days of fasting, suggesting that refeeding at this time would effectively improve the ingestion rate of L. crocea juveniles. Certainly, the inference needs to be verified by a recovery feeding experiment.

Reference (43)

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return