Cloning and functional analysis of the calreticulin gene from the scleractinian coral Galaxea astreata
-
Abstract: Calreticulin (CRT) is a highly conserved Ca2+-binding protein and chaperone in the endoplasmic reticulum, which mainly participates in adjusting calcium level and directing proper conformation of proteins. Here, we cloned the crt gene of the scleractinian coral Galaxea astreata, named Gacrt, and analysed its ability to drive bacterial agglutination. The full-length Gacrt cDNA consisted of 1 792 nucleotides and contained a 77 bp 5’ untranslated region (UTR), a 380 bp 3’ UTR and a 1 335 bp open reading frame (ORF) that encoded a 444 amino acid protein. The deduced peptide possessed a signal peptide domain, an endoplasmic reticulum retrieval signal sequence (KDEL), two potential calreticulin family signature motifs and a set of triplicate repeats. We also found that the recombinant GaCRT protein could promote agglutination of both the Gram-positive bacterium Micrococcus luteus and the Gram-negative bacterium Escherichia coli. These results show that the GaCRT protein can enhance bacterial agglutination, hinting that GaCRT is an immune-relevant molecule involved in host defense against bacterium.
-
Key words:
- Galaxea astreata /
- calreticulin /
- bacterial agglutination
-
Figure 1. Nucleotide and putative amino acid sequence of Gacrt. The predicted signal peptide is indicated by the dotted line. The two calreticulin-family signature sequences are marked with dotted boxes. Triplicate repeats are highlighted with lines. The ER retrieval signal sequence (KDEL) is enclosed in an oval. The Kozak consensus sequence is in a transparent box, and the polyadenylation signal is in the grey box.
Figure 3. Cluster analysis of CRT amino acid sequences. The sequence isolated in this study is marked with box. Numbers of each node indicated the percentage of bootstrapping of a 1 000 replications.
Figure 4. pET32a-GaCRT prokaryotic expression. a. M: protein molecular weight marker; 1: rGaCRT without induction; 2: rGaCRT induced with IPTG; 3: pET-32a. b. 1: purified protein, M: protein molecular weight marker. The rGaCRT protein is highlighted with a box.
Table 1. Primers for Gacrt cloning and prokaryotic expression
Primer Sequence (5′-3′) Function Gacrt-F ATAGCAATGCGTCAGTTGT middle fragment PCR Gacrt-R TAGCAGAAGACCCGAAAA Gacrt-5′-outer GGTGAAGAGAAATCAGAGGAAGGGGGA 5′-RACE Gacrt-5′-inner TCTGCGCTTCACATAATAGATCCTGTG Gacrt-3′-outer CGTAACCACCTCCACAATCAATGCTCTG 3′-RACE Gacrt-3′-inner CGTCGAACTTGGCCGAAAGTCCGTA Gacrt-ORF F CGCGGATCCATGGAACTTTGCCGTTTAAT double enzyme digestion primer Gacrt-ORF R CCCAAGCTTTTAAAGTTCATCTTTGGGTGC 
下载: 导出CSV
-
[1] Baksh S, Michalak M. 1991. Expression of calreticulin in Escherichia coli and identification of its Ca2+ binding domains. The Journal of Biological Chemistry, 266(32): 21458–21465. doi: 10.1007/BF00006813 [2] Corbett E F, Oikawa K, Francois P, et al. 1999. Ca2+ regulation of interactions between endoplasmic reticulum chaperones. The Journal of Biological Chemistry, 274(10): 6203–6211. doi: 10.1074/jbc.274.10.6203 [3] Duan Yafei, Liu Ping, Li Jitao, et al. 2014. Molecular responses of calreticulin gene to Vibrio anguillarum and WSSV challenge in the ridgetail white prawn Exopalaemon carinicauda. Fish & Shellfish Immunology, 36(1): 164–171. doi: 10.1016/j.fsi.2013.10.024 [4] Dunlap W C, Starcevic A, Baranasic D, et al. 2013. KEGG orthology-based annotation of the predicted proteome of Acropora digitifera: zoophyteBase-an open access and searchable database of a coral genome. BMC Genomics, 14: 509. doi: 10.1186/1471-2164-14-509 [5] Fischer C R, Mikami M, Minematsu H, et al. 2017. Calreticulin inhibits inflammation-induced osteoclastogenesis and bone resorption. Journal of Orthopaedic Research, 35(12): 2658–2666. doi: 10.1002/jor.23587 [6] Gold L I, Eggleton P, Sweetwyne M T, et al. 2010. Calreticulin: non-endoplasmic reticulum functions in physiology and disease. The FASEB Journal, 24(3): 665–683. doi: 10.1096/fj.09-145482 [7] Gu V Y, Wong M H, Stevenson J L, et al. 2008. Calreticulin in human pregnancy and pre-eclampsia. Molecular Human Reproduction, 14(5): 309–315. doi: 10.1093/molehr/gan017 [8] Hayward D C, Hetherington S, Behm C A, et al. 2011. Differential gene expression at coral settlement and metamorphosis—a subtractive hybridization study. PLoS One, 6(10): e26411. doi: 10.1371/journal.pone.0026411 [9] Jia Xiaoyun, Xu Chongyi, Jing Ruilian, et al. 2008. Molecular cloning and characterization of wheat calreticulin (CRT) gene involved in drought-stressed responses. Journal of Experimental Botany, 59(4): 739–751. doi: 10.1093/jxb/erm369 [10] Kenkel C D, Bay L K. 2017. Novel transcriptome resources for three scleractinian coral species from the Indo-Pacific. Gigascience, 6(9): 1–4. doi: 10.1093/gigascience/gix074 [11] Kobylewski S E, Henderson K A, Yamada K E, et al. 2017. Activation of the EIF2α/ATF4 and ATF6 pathways in du-145 cells by boric acid at the concentration reported in men at the US mean boron intake. Biological Trace Element Research, 176(2): 278–293. doi: 10.1007/s12011-016-0824-y [12] Li Shuo, Xie Liping, Meng Qingxiong, et al. 2006. Significance of the extra C-terminal tail of CaLP, a novel calmodulin-like protein involved in oyster calcium metabolism. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 144(4): 463–471. doi: 10.1016/j.cbpb.2006.04.010 [13] Liu Xuemei, Xu Na, Zhang Shicui. 2013. Calreticulin is a microbial-binding molecule with phagocytosis-enhancing capacity. Fish & Shellfish Immunology, 35(3): 776–784. doi: 10.1016/j.fsi.2013.06.013 [14] Michalak M, Corbett E F, Mesaeli N, et al. 1999. Calreticulin: one protein, one gene, many functions. Biochemical Journal, 344(2): 281–292. doi: 10.1042/bj3440281 [15] Ostwald T J, MacLennan D H. 1974. Isolation of a high affinity calcium-binding protein from sarcoplasmic reticulum. The Journal of Biological Chemistry, 249(3): 974–979. doi: 10.1007/BF01520862 [16] Peatman E, Baoprasertkul P, Terhune J, et al. 2007. Expression analysis of the acute phase response in channel catfish (Ictalurus punctatus) after infection with a Gram-negative bacterium. Developmental & Comparative Immunology, 31(11): 1183–1196. doi: 10.1016/j.dci.2007.03.003 [17] Qiu Yuanyuan, Michalak M. 2009. Transcriptional control of the calreticulin gene in health and disease. The International Journal of Biochemistry & Cell Biology, 41(3): 531–538. doi: 10.1016/j.biocel.2008.06.020 [18] Smith M J, Koch G L. 1989. Multiple zones in the sequence of calreticulin (CRP55, calregulin, HACBP): a major calcium binding ER/SR protein. The EMBO Journal, 8(12): 3581–3586. doi: 10.1002/j.1460-2075.1989.tb08530.x [19] Wang F I, Chen J C. 2006. Effect of salinity on the immune response of tiger shrimp Penaeus monodon and its susceptibility to Photobacterium damselae subsp. damselae. Fish & Shellfish Immunology, 20(5): 671–681. doi: 10.1016/j.fsi.2005.08.003 [20] Wang Yan, Zhou Jianjiang, Xie Yuan, et al. 2013. Expressions of calmodulin, calreticulin and cyclin-dependent kinase 1 genes in gastric cancer tissues. Cancer Research on Prevention and Treatment (in Chinese), 40(2): 151–154 [21] Xia Xiulin, Wang Guiling, Bai Zhiyi, et al. 2013. Molecular characterization and expression analysis of calreticulin cDNA from Hyriopsis cumingii. Journal of Fisheries of China (in Chinese), 37(5): 679–687. doi: 10.3724/SP.J.1231.2013.38454 [22] Yuyama I, Ito Y, Watanabe T, et al. 2012. Differential gene expression in juvenile polyps of the coral Acropora tenuis exposed to thermal and chemical stresses. Journal of Experimental Marine Biology and Ecology, 430–431: 17–24. doi: 10.1016/j.jembe.2012.06.020 [23] Zhang Guangming, Schmidt O, Asgari S. 2006. A calreticulin-like protein from endoparasitoid venom fluid is involved in host hemocyte inactivation. Developmental & Comparative Immunology, 30(9): 756–764. doi: 10.1016/j.dci.2005.11.001 [24] Zhuo Ruiqun, Zhou Tingting, Yang Shiping, et al. 2017. Characterization of a molt-related myostatin gene (FmMstn) from the banana shrimp Fenneropenaeus merguiensis. General and Comparative Endocrinology, 248: 55–68. doi: 10.1016/j.ygcen.2017.03.010 -
点击查看大图
图(5) / 表(1)
计量
- 文章访问数: 155
- HTML全文浏览量: 37
- PDF下载量: 4
- 被引次数: 0
