+Advanced Search

Advanced Search

Volume 40 Issue 9
Sep.  2021
Turn off MathJax
Article Contents
Abstract
1. Introduction
2. Materials and methods
3. Results
4. Discussion
References
Article Navigation >  Acta Oceanologica Sinica  > 2021  >  40(9): 74-81
Jian Zheng, Bingjie Chen, Tianxiang Gao, Na Song. The mitochondrial genome of Chaeturichthys stigmatias provides novel insight into the interspecific difference with Amblychaeturichthys hexanema[J]. Acta Oceanologica Sinica, 2021, 40(9): 74-81. doi: 10.1007/s13131-021-1787-1
Citation: Jian Zheng, Bingjie Chen, Tianxiang Gao, Na Song. The mitochondrial genome of Chaeturichthys stigmatias provides novel insight into the interspecific difference with Amblychaeturichthys hexanema[J]. Acta Oceanologica Sinica, 2021, 40(9): 74-81. doi: 10.1007/s13131-021-1787-1
shu

The mitochondrial genome of Chaeturichthys stigmatias provides novel insight into the interspecific difference with Amblychaeturichthys hexanema

doi: 10.1007/s13131-021-1787-1
  • 1.

    Key Laboratory of Mariculture of Ministry of Education, Ocean University of China, Qingdao 266003, China

  • 2.

    Fishery College, Zhejiang Ocean University, Zhoushan 316022, China

Funds:  The National Key R&D Program of China under contract No. 2018YFD0900905; the National Natural Science Foundation of China under contract No. 41776171.
More Information
  • Corresponding author: E-mail: songna624@163.com
  • Received Date: 2020-06-17
  • Accepted Date: 2020-08-24
    • Available Online: 2021-07-23
  • Publish Date: 2021-09-30
    Abstract
  • Chaeturichthys stigmatias and Amblychaeturichthys hexanema belong to the family Gobiidae, which are offshore warm fish species and widely distribute in the western Pacific Ocean. In this study, the mitochondrial cytochrome c oxidase subunit I (COI) sequences and 12S ribosomal RNA (12S rRNA) sequences were used to analyze the interspecific differences between the two species. The phylogenetic analysis showed that the interspecific distance was significantly higher than the intraspecific genetic distance. The Neighbor-Joining tree showed two separate clusters, without sharing haplotype. The mitochondrial genome sequence of C. stigmatias was also reported. This genome was 17 134 bp in size, with a high A+T content of 55.9%. The phylogenetic analysis based on the tandem 13 coding protein genes nucleotide sequences indicated that C. stigmatias showed a close relationship with A. hexanema. This study can provide the basic genetic data for two species and will help for constructing the phylogeny of the Gobiiade.
    • FullText(HTML)

  • Chaeturichthys stigmatias and Amblychaeturichthys hexanema, belong to the Gobiiade, Perciforms (Wu and Zhong, 2008). They are offshore warm fish species which are widely distributed in Korea, Japan and China. Chaeturichthys stigmatias mainly inhabits the sandy-mud bottom and lives on benthonic fauna (Chen et al., 2016). It was reported to be the dominant species in the Huanghe River Estuary and its adjacent waters (Meng et al., 2017). Amblychaeturichthys hexanema mainly inhabits the shallow and estuarine waters (Li et al., 2000) and lives on more than 40 kinds of food organisms (Han et al., 2013).

    The morphological characters like body shape and color of C. stigmatias are similar to A. hexanema (Nelson et al., 2006), and then they are often wrongly classified. Both species roughly have the same number of fin ray and fin spines on their first dorsal fin. Besides, they have 3−4 pairs of short tentacles on the chin of both species, which are different from most other gobies. The dorsal fins of these two species have scattered black stripes, while C. stigmatias has a black spot on the posterior of the first dorsal fin (Wu and Zhong, 2008). However, this characteristic is often not obvious enough to distinguish them. Previous ichthyologic researches had placed them into the Chaeturichthys genus (East China Sea Fishery Research Institute of Chinese Academy of Fishery Sciences, 1990). Qu (2018) thought that C. stigmatias and A. hexanema were very similar in morphology and showed closely genetic relationship in morphological tree among 28 goby fish. The otolith morphology of the two species was also relatively similar, and it was difficult to distinguish them (Yu, 2014).

    There have been abundant reports on morphology, otolith, ingestion of C. stigmatias and A. hexanema until now (Mei et al., 2010; Han et al., 2013; Meng et al., 2017). However, few genetic studies of C. stigmatias and A. hexanema were conducted. The complete mitochondrial sequences of C. stigmatias (KC495071.1) and A. hexanema (KT781104) were determined (Sun et al., 2015; Jin et al., 2012), however, two complete mitochondrial genomes showed high homology. The structures of mtDNA D-loop region and mitochondrial cytochrome c oxidase subunit I (COI) sequence between the two sequences are also basically the same. Therefore, these two species may have been misidentified.

    The molecular tools like DNA barcoding are often required to identify marine fish because the morphological characters of many species are too similar to identify (Smith et al., 2008). The mitochondrial COI gene, usually used as DNA barcoding, has been widely used in species identification (Wang et al., 2018; Puckridge et al., 2013), description of new record species or new species (Guo et al., 2010; Gao et al., 2011) and discovery of cryptic species (Zemlak et al., 2009; Suh et al., 2019). Besides, 12S rRNA gene has been recently developed as DNA mini-barcoding. It can be used in environmental samples needing universal primers, processed biological material such as food products and archival specimens of DNA degradation because it has shorter length and can be more efficient amplification (Meusnier et al., 2008; Shokralla et al., 2015). Masaki et al. (2015) aligned whole 12S rRNA sequences from 180 species and designed a set of universal PCR primers (MiFish-U/E) of fish, and they have been widely used for identification of marine fish.

    This study re-determined the complete mitochondrial genome of C. stigmatias and analyzed the interspecific difference between C. stigmatias and A. hexanema by COI gene and 12S rRNA gene. This study is conducive to reconstruct the phylogeny of the Gobiiade and can provide effective basic data for two goby species.

    2.1 Sample collection

    A total of 30 ind. of C. stigmatias and 24 ind. of A. hexanema from the seacoast of Qingdao, Shandong Province, China, were collected in this study. The information of samples was shown in Table 1. The two goby species were initially identified by the morphological characters like black spot on the first dorsal fin, and then COI and 12S rRNA sequences were amplified and analyzed. A piece of skeletal muscle of these samples was excised for DNA extraction and preserved in 95% ethanol until use. The COI sequences and 12S rRNA sequences of 30 ind. of C. stigmatias and 24 ind. of A. hexanema were amplified for studying the interspecific difference. One ind. of C. stigmatias was used for determining its complete mitochondrial genome sequence.

    Table  1.  The sampling information of C. stigmatias and A. hexanema
    SpeciesSampling siteSampling timeSample number/ind.Body length/mmWeight/g
    C. stigmatiasQingdaoDec. 20183094.75−196.174.4−39.4
    A. hexanemaQingdaoDec. 20182467.63−133.062.7−20.3
     | Show Table
    DownLoad: CSV

    2.2 DNA extraction, PCR amplification and sequencing

    Total genomic DNA was isolated from the muscle tissue by proteinase K digestion followed by the standard phenol/chloroform method (Sambrook et al., 1989).

    Primers used for the amplification of the COI gene were F1-5′-TCAACCAACCACAAAGACATTGGCAC-3′ and R1-5′-TAGACTT CTGGGTGGCCAAAGAATCA-3′ (Ward et al., 2008), and the 12S rRNA sequences were amplified by primers, MiFish-U-F: 5′-GTCGGTAAAACTCGTGCCAGC-3′ and MiFish-U-R: 5′-CATAGTGGGGTATCTAATCCCAGTTTG-3′ (Masaki et al., 2015).

    All PCRs were performed in an Eppendorf thermal cycler (A300 Fast Thermal Cycler). TaKaRa Ex Taq were used for polymerase chain reaction (PCR). PCR was carried out in 25 µL volumes containing 0.15 µL Taq DNA polymerase, 1 µL template DNA, 2.5 µL 10× DNA loading buffer, 2 µL dNTP, 1 µL forward and reverse primer. The PCR amplification was carried out under the following conditions: 3 min initial denaturation at 95°C, and 40 cycles of 45 s at 94°C for denaturation, 45 s at 52°C for annealing, and 45 s at 72°C for extension, and a final extension at 72°C for 5 min (Liu et al., 2007).

    Subsequent complete sequence of C. stigmatias was accomplished by primer walking method. Thirty-five normal PCR primer sets were designed to accomplish the entire mitogenome (Table A1). It was essential that every two contiguous segments overlapped by at least 50 bp to ascertain the accuracy of sequencing. The PCR amplification process was the same as above except for the annealing temperature. The annealing temperature of primers were shown in Table A1.

    All PCR products were detected by 2% agarose gel electrophoresis, the products with good amplification effect were sent to Tsingke Biotech Co., Ltd. (China) for sequencing. To ensure the accuracy of the sequences, each sample was sequenced in both directions.

    2.3 Sequence analysis

    The obtained sequences were analyzed by DNASTAR software (Madison, USA). ARLEQUIN 3.5 was used to calculate haplotype diversity (h), and nucleotide diversity (π) (Excoffier et al., 2005). Nucleotide composition and genetic distance were analyzed using MEGA 5 based on the Kimura 2-parameter model (Tamura et al., 2011).

    The mitochondrial genome sequence alignment was performed initially using DNASTAR software (Madison, USA) with default parameters, and further adjusted manually (Burland, 2000). Locations for protein-coding genes and rRNAs were determined by DOGMA (Wyman et al., 2004) with default settings.

    Phylogenetic analysis was constructed by Neighbor-joining (NJ) analysis with MEGA 5.0 (Saitou and Nei, 1987; Tamura et al., 2011). The bootstrap values in NJ analysis was 1 000 (Felsenstein, 1985).

    3.1 The interspecific difference between C. stigmatias and A. hexanema

    In this study, the length of COI homologous fragments of C. stigmatias and A. hexanema was 622 bp (GenBank accession: MT568667-MT568696 and MT568697-MT568720). The average base composition content of C. stigmatias was 23.6% for A, 26.9% for C, 18.2% for G, 31.3% for T, and A. hexanema was 23.8% for A, 28.0% for C, 19.0% for G, 29.2% for T. The content of C+G was slightly higher than that of C. stigmatias.

    A total of 9 polymorphic sites, 7 transition and 2 transversion were detected in 30 ind. of C. stigmatias. These sequences could be defined as 11 haplotypes. Besides, a total of 13 polymorphic sites, 11 transition and 2 transversion were detected in 24 ind. of A. hexanema, and 7 haplotypes were defined by these sites. No base insertions or deletions were detected within the two species.

    The number of haplotype and haplotype diversity of two gobies obtained based on the COI gene were shown in Table 2. The genetic diversity parameters of C. stigmatias were higher than those of A. hexanema. The intraspecific genetic distance of A. hexanema and C. stigmatias was 0.002 and 0.003, respectively, and the intraspecific genetic distance between two species was 0.187. Clustering analysis of COI haplotypes was conducted using NJ method (Fig. 1). The result showed that the two species clustered separately, without sharing haplotype.

    Table  2.  Genetic diversity parameters of C. stigmatias and A. hexanema based on COI gene
    ParameterA. hexanemaC. stigmatias
    Sample number/ind.2430
    Haplotypes number/ind. 711
    Haplotype diversity0.445 7±0.126 00.564 4±0.037 6
    Nucleotide diversity0.002 0±0.001 40.002 9±0.001 9
     | Show Table
    DownLoad: CSV
    Figure  1.  Neighbor-joining tree for COI haplotypes of A. hexanema and C. stigmatias. Bootstrap values of >70% (out of 1 000 replicates) are shown on the nodes.
    DownLoad: Full-Size Img PowerPoint

    A total of 194 bp 12S rRNA gene homologous fragments of C. stigmatias and A. hexanema were amplified (GenBank accession: MT614220-MT614249 and MT614190-MT614213). The contents of A, T, C and G of C. stigmatias and A. hexanema were 20.6%, 34.9%, 20.3%, 24.2% and 20.8%, 32.5%, 22.2%, 24.5%, respectively. The content of A+T was slightly higher than that of G+C, which was similar to the characteristics of higher A+T content in other fishes (Sun et al., 2012; Liu et al., 2012).

    A total of 1 polymorphic site was found within the 12S rRNA sequences. Two haplotypes were defined by these sites in the 30 ind. of C. stigmatias (Table 3). There was 1 polymorphic site in the 12S rRNA sequences of 24 ind. A. hexanema. This site could be defined as 2 haplotypes (Table 3). The NJ phylogenetic tree constructed by haplotypes of this two species showed that the two species could be clearly divided into two branches, which was consistent with the analysis results of the COI sequences (Fig. 2).

    Table  3.  Genetic diversity parameters of C. stigmatias and A. hexanema based on 12S rRNA gene
    ParameterA. hexanemaC. stigmatias
    Sample number/ind.2430
    Haplotypes number/ind. 2 2
    Haplotype diversity0.507 2±0.044 50.516 9±0.031 4
    Nucleotide diversity0.002 6±0.002 60.002 7±0.002 6
     | Show Table
    DownLoad: CSV
    Figure  2.  Neighbor-joining tree for 12S rRNA haplotypes of A. hexanema and C. stigmatias.
    DownLoad: Full-Size Img PowerPoint

    3.2 Complete sequence analysis

    The mitochondrial genome of C. stigmatias was acquired (MN038166), and it was 17 134 bp in length, covering 13 protein-coding genes, 22 tRNA, 2 rRNA genes, 1 OL and 1 D-loop region (Fig. 3). The overall nucleotide composition was 28.2% for A, 27.7% for T, 28.0% for C, and 16.1% for G, with a slight AT bias of 55.9%, which was similar to other goby fishes (Jin et al., 2012). In 13 protein-coding genes, the longest one was ND5 (1 842 bp in length), whereas the shortest one was ATP8 (165 bp in length). The lengths of tRNA genes were ranged from 64 bp (tRNA-Cys) to 74 bp (tRNA-Val, tRNA-Asn). As other vertebrates, with the exception of ND6 and 8 tRNAs (tRNA-Ala, tRNA-Asn, tRNA-Cys, tRNA-Gln, tRNA-Tyr, tRNA-Pro, tRNA-Glu, tRNA-Ser), all of the observed mitochondrial genes were found to be encoded on H strand.

    Figure  3.  The gene map of the complete mitochondrial genome of C. stigmatias. Genes encoded on the H-strand and L-strand are shown outside and inside the circular map of the mitogenome, respectively.
    DownLoad: Full-Size Img PowerPoint

    All the protein-coding genes started with the ATG codon except for COI and ND6, that started with GTG and CTA, respectively. Two types of stop codons were used by the coding genes: TAA (ND1, ND2, COI, ATP8, ATP6, ND4L, and ND5) and incomplete stop codon T (COII, COIII, ND3, ND4, and ND6). The control region (D-loop) was 992 bp sequence located between the tRNA-Pro and tRNA-Phe genes. The 12S rRNA and 16S rRNA were located between the tRNA-Phe and tRNA-Leu genes and separated by the tRNA-Val gene. Sequence analysis showed that many overlaps between genes (Table 4).

    Table  4.  Complete mitochondrial genome characteristics of C. stigmatias
    GeneStart position/bpStop position/bpSize/bpIntergenic nucleotideStart codonStop codonStrand
    tRNA-Phe168680−−H
    12S rRNA691 0179490−−H
    tRNA−Val1 0181 091740−−H
    16S rRNA1 0922 7741 6830−−H
    tRNA−Leu2 7752 847730−−H
    ND12 8483 8229753ATGTAAH
    tRNA−Ile3 8263 89570−1−−H
    tRNA−Gln3 8953 964701−−L
    tRNA−Met3 9664 033681−−H
    ND24 0355 0791 044−2ATGT − −H
    tRNA−Trp5 0785 149720−−H
    tRNA−Ala5 1505 221720−−L
    tRNA−Asn5 2225 295741−−L
    tRNA−Cys5 3275 390640−−L
    tRNA−Tyr5 3915 461713−−L
    COXI5 4657 0181 5540GTGTAAH
    tRNA−Ser7 0197 089713−−L
    tRNA−Asp7 0937 163712−−H
    COXII7 1667 8566911ATGT − −H
    tRNA−Lys7 8587 931740−−H
    ATP87 9328 096165−5ATGTAAH
    ATP68 0908 7736840ATGTAAH
    COXIII8 7749 5577840ATGT − −H
    tRNA−Gly9 5589 629720−−H
    ND39 6309 9783490ATGT − −H
    tRNA−Arg9 97910 046680−−H
    ND4L10 04710 3432970ATGTAAH
    ND410 34411 7241 3810ATGT − −H
    tRNA−His11 72511 79470−1−−H
    tRNA−Ser11 79411 861685−−H
    tRNA−Leu11 86711 939730−−H
    ND511 94013 7811 842−1ATGTAAH
    ND613 78114 7921 0120CTAT − −L
    tRNA−Glu14 79314 863710−−L
    Cyt b14 86416 0001 1375ATGTAAH
    tRNA−Thr16 00116 07272−1−−H
    tRNA−Pro16 07216 142710−−L
    D−loop16 14317 134992−−−H
    Note: H represents genes encoded on the H-strand; L, genes encoded on L-strand. −, no data.
     | Show Table
    DownLoad: CSV

    Phylogenetic tree based on the tandem 13 coding protein genes nucleotide sequences was constructed by NJ method (Fig. 4). From the tree topologies, this study could conclude that C. stigmatias was genetically closest to A. hexanema, and then to Oxyurichthys formosanus among 12 species within Gobioidei.

    Figure  4.  The phylogenetic analyses investigated using Neighbor-Joining based on nucleotide sequences of 13 concatenated protein-coding genes. Cyprinus carpio (GenBank: KP993139) was used as an outgroup. The black box represented sequences of C. stigmatias sequenced in this study.
    DownLoad: Full-Size Img PowerPoint

    DNA barcoding developed in recent years is an effective and efficient molecular tool used in species identification, especially for closely related fish species (Stoeckle, 2003; Hebert et al., 2003a, b). For example, Ward et al. (2005) analyzed the COI gene of 270 species of marine fish and resulted in all fish species could be discriminated by the COI gene. Compared with the conventional DNA barcoding, mini-barcoding like 12S rRNA barcoding was developed recently. It has shorter length and can be efficiently amplified, which can overcome some problems existing in traditional DNA barcoding, such as DNA degradation in biological food products and old archival specimens, high sequence variability in environmental samples (Meusnier et al., 2008; Shokralla et al., 2015).

    A1.  Primers for complete mitochondrial genome of C. stigmatias
    Primer name Primer sequence (5′−3′) Temperature/°C Reference
    MiFish-U F: GTCGGTAAAACTCGTGCCAGC 52 Miya et al. (2015)
    R: CATAGTGGGGTATCTAATCCCAGTTTG
    C1 F: AACCCTATTCACAGCAACAT 48 this study
    R: TGAGCAGTCCTAAGATAGTAAC
    C2 F: GCCCTAACAACCCTATTCA 52 this study
    R: AAGGCGACGATGAAGATG
    C3 F: GGTAAGGTTCTGCTGCTAA 50 this study
    R: ATCGGCGGTGTAGTGTAT
    16S F: GGTTTGAACTCAGATCATGT 52 Miya et al. (2015)
    R: GGTTTGAACTCAGATCATGT
    C4 F: TGCGAGCATGATACCATAA 52 this study
    R: GATTATCATCCGCCTATGCTA
    C5 F: CCAACATCTGAAGGTCCAC 48 this study
    R: GGTACGAAGATTAGCAGTCT
    C6 F: TCCTTAATTGCCTACTCATCC 48 this study
    R: GGTACGAAGATTAGCAGTCT
    C7 F: TAACAGGCATTGGCACTC 52 this study
    R: GTCAGCGAACTCAAGAATAG
    C8 F: AGACTGCTAATCTTCGTACC 54 this study
    R: GTTTGCTGTGACAAGAATGA
    C9 F: CACTTATAACCGCATGATGG 50 this study
    R: GGTACGAAGATTAGCAGTCT
    C10 F: GCCACATAAGCCTCGTAG 48 this study
    R: CCATCAGCCAATGAGTAAGA
    COI F: TCAACCAACCACAAAGACATTGGCAC 52 Ward et al. (2008)
    R: TAGACTTCTGGGTGGCCAAAGAATCA
    C11 F: GCCACCAACCTTAACTCTT 50 this study
    R: ACTCCATCTCAAGCAATCAG
    C12 F: GGCGACATCGGACTAATC 48 this study
    R: GGTATTGCTTGCTGTTGTT
    C13 F: CACTGATTGCTTGAGATGG 54 this study
    R: TGCGAGGAATGTAGTTAGG
    C14 F: CATAGGATAGCCATCAACCA 52 this study
    R: TGTCAGCGGTGTAGTGTA
    C15 F: TAACAACAGCAAGCAATACC 52 this study
    R: AGAAAATGTGTCCACGAGTT
    C16 F: GCAGTTTTACCAGCGAGC 52 this study
    R: GGCGATGTGTTGGGATGT
    C17 F: ACTTCGGTTCAAAGGTCAT 48 this study
    R: GCCGATGTGTTGGGATGTT
    C18 F: TTATGTTGAATAAGTTA 48 this study
    R: TATTACATAAAATTAACA
    C19 F: TATTACATAAATTTAACTAT 46 this study
    R: TCGGTCTGTAAGAAGCATAG
    C20 F: CTTCGGTTCAAAGGTCAT 54 this study
    R: GTAGTGGAGGTGAAGCGA
    C21 F: CAGGTAAAGCACAGTAGAGT 52 this study
    R: CCTTTCATTTGGCATTTCAG
    C22 F: TTACCAGCGAGCATCACCT 52 this study
    R: GTAGTGGAGGTGAAGCGAA
    C23 F: TTTTACCAGCGAGCATCACC 56 this study
    R: GTAGTGGAGGTGAAGCGAAA
    C24 F: AATCCAGGTCGGTTTCTATC 50 this study
    R: CTTGCTTGTGCGTGACTT
    C25 F: CAGGTCGGTTTCTATCTATG 48 this study
    R: TCTTCGCCCTTATTATCG
    C26 F: AGGTCGGTTTCTATCTATG 52 this study
    R: GTCCAGCCAAAGATAGATA
    C27 F: TTATGTTGAATAAGTTAATAT 48 this study
    R: AGAAAATGTGTCCACGAGTT
    C28 F: TATTACATAAAATTAACAATAA 52 this study
    R: GGCTACAATCCACCACTTA
    C29 F: CAGCGGTTCTTCTACTCTT 54 this study
    R: TCCTGCGAATATAACTCCAA
    C30 F: TCTCAACCACATTAACCGTA 48 this study
    R: CGTATAACAGCCTTGAAGATG
    C31 F: CTGTAGAGTGAACGCTTGGCATG 50 this study
    R: CCCATCTCTAGCTCCCAAAGC
    C32 F: GTGCGGATACTTGCATGTGT 52 this study
    R: TTAGCGCTGCACTCTGAAAT
     | Show Table
    DownLoad: CSV

    In this study, the result of conventional COI barcoding and 12S rRNA mini-barcoding analysis all indicated that there were significant genetic differences between C. stigmatias and A. hexanema, and the NJ tree based on COI and 12S rRNA haplotypes showed that the two species were clustered separately, which verified the validity of these two barcoding in interspecific identification. Therefore, combination of morphology and DNA barcoding to solve the problems of classification and identification will be more effective and accurate (Cywinska et al., 2006; Pfenninger et al., 2007).

    The mitochondrial genome has been widely used in evolutionary biology, population genetics and molecular ecology (Inoue et al., 2001; Miya et al., 2005; Lavoué et al., 2007). It has been proved that mitogenomic data can be used to resolve the controversial problems of phylogenetic relationships (Miya et al., 2003; Boore, 2006). In this study, the mitochondrial genome sequence of C. stigmatias was 17 134 bp, which was shorter than the sequence previously reported (Sun et al., 2015). This is due to the fact that there was repeat region in D-loop region of C. stigmatias previously reported. Some researchers have reported the COI sequence of C. stigmatias (Xing et al., 2018; Lu et al., 2016). These sequences were high homology with the COI sequences determined in this study, which showed significant difference with that in previous study. Therefore, C. stigmatias in previous study may have been misidentified as A. hexanema. The phylogenetic tree showed that the sequence of C. stigmatias clustered with most of Gobioidei. Phylogenetic analysis suggested that C. stigmatias had a close relationship with A. hexanema, which was consistent with the study result of morphological classification (Qu, 2018). The mitochondrial genome of C. stigmatias characterized in the present study would facilitate further studies on the genetic constitution of C. stigmatias population. It would also enrich essential information for investigating the biodiversity and conservation biology of C. stigmatias.

    • References(47)
  • [1]
    Boore J L. 2006. The use of genome-level characters for phylogenetic reconstruction. Trends in Ecology & Evolution, 21(8): 439–446
    [2]
    Burland T G. 2000. DNASTAR’s lasergene sequence analysis software. In: Misener S, Krawetz S A, eds. Bioinformatics Methods and Protocols. Totowa, NJ: Humana Press, 71–91
    [3]
    Chen Fenfang, Ma Hongyu, Ma Chunyan, et al. 2016. The complete mitochondrial genome sequence and gene organization of Amblychaeturichthys hexanema (Gobiidae: Amblychaeturichthys) with phylogenetic consideration. Mitochondrial DNA Part A, 27(6): 4687–4688. doi: 10.3109/19401736.2015.1106503
    [4]
    Cywinska A, Hunter F F, Hebert P D N. 2006. Identifying Canadian mosquito species through DNA barcodes. Medical and Veterinary Entomology, 20(4): 413–424. doi: 10.1111/j.1365-2915.2006.00653.x
    [5]
    East China Sea Fishery Research Institute of Chinese Academy of Fishery Sciences. 1990. The Fishes of Shanghai (in Chinese). Shanghai: Shanghai Scientific & Technical Publishers
    [6]
    Excoffier L, Laval G, Schneider S. 2005. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1: 47–50
    [7]
    Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39(4): 783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x
    [8]
    Gao Tianxiang, Ji Dongping, Xiao Yongshuang, et al. 2011. Description and DNA barcoding of a new Sillago species, Sillago sinica (Perciformes: Sillaginidae), from coastal waters of China. Zoological Studies, 50(2): 254–263
    [9]
    Guo Enmian, Liu Yuan, Liu Jing, et al. 2010. DNA barcoding discriminates Pampus minor (Liu et al., 1998) from Pampus species. Chinese Journal of Oceanology and Limnology, 28(6): 1266–1274. doi: 10.1007/s00343-010-9917-1
    [10]
    Han Dongyan, Xue Ying, Ji Yupeng, et al. 2013. Feeding ecology of Amblychaeturichthys hexanema in Jiaozhou Bay, China. Chinese Journal of Applied Ecology (in Chinese), 24(5): 1446–1452
    [11]
    Hebert P D N, Cywinska A, Ball S L, et al. 2003a. Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270(1512): 313–321. doi: 10.1098/rspb.2002.2218
    [12]
    Hebert P D N, Ratnasingham S, Dewaard J R. 2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society B: Biological Sciences, 270(Suppl 1): S96–S99
    [13]
    Inoue J G, Miya M, Tsukamoto K, et al. 2001. A mitogenomic perspective on the basal teleostean phylogeny: resolving higher-level relationships with longer DNA sequences. Molecular Phylogenetics and Evolution, 20(2): 275–285. doi: 10.1006/mpev.2001.0970
    [14]
    Jin Xiaoxiao, Wang Rixin, Xu Tianjun, et al. 2012. Complete mitochondrial genome of Oxuderces dentatus (Perciformes, Gobioidei). Mitochondrial DNA, 23(2): 142–144. doi: 10.3109/19401736.2012.660930
    [15]
    Lavoué S, Miya M, Saitoh K, Ishiguro N B, et al. 2007. Phylogenetic relationships among anchovies, sardines, herrings and their relatives (Clupeiformes), inferred from whole mitogenome sequences. Molecular Phylogenetics and Evolution, 43(3): 1096–1105. doi: 10.1016/j.ympev.2006.09.018
    [16]
    Li Yongzhen, Chen Guobao, Sun Dianrong. 2000. Analysis of the composition of fishes in the Pearl River estuarine waters. Journal of Fisheries of China (in Chinese), 24(4): 312–317
    [17]
    Liu Jinxian, Gao Tianxiang, Wu Shifang, et al. 2007. Pleistocene isolation in the Northwestern Pacific marginal seas and limited dispersal in a marine fish, Chelon haematocheilus (Temminck & Schlegel, 1845). Molecular Ecology, 16(2): 275–288
    [18]
    Liu Lianwei, Xu Qianghua, Chen Xinjun. 2012. Population genetic structure of Ommastrephes bartramii in the North Pacific Ocean based on the COI and Cytb gene sequences analysis. Journal of Fisheries of China (in Chinese), 36(11): 1675–1684. doi: 10.3724/SP.J.1231.2012.27955
    [19]
    Lu Zhichuang, Xu Shengyong, Song Na, et al. 2016. Analysis of the diet of finless porpoise (Neophocaena asiaeorientalis sunameri) based on prey morphological characters and DNA barcoding. Conservation Genetics Resources, 8(4): 523–531. doi: 10.1007/s12686-016-0575-2
    [20]
    Masaki M, Yukuto S, Fukunaga, et al. 2015. Analytical pipeline for DNA sequences amplified by mifish primers. Biological Journal of the Linnean Society, 73: 259–316
    [21]
    Mei Chun, Xu Binduo, Xue Ying, et al. 2010. Fish community structure and species diversity during autumn and winter in the central waters of Jiaozhou Bay. Journal of Fishery Sciences of China (in Chinese), 17(1): 110–118
    [22]
    Meng Kuankuan, Wang Jing, Zhang Chongliang, et al. 2017. The fishery biological characteristics of Chaeturichthys stigmatias in the Yellow River Estuary and its adjacent waters. Journal of Fishery Sciences of China (in Chinese), 24(5): 939–945. doi: 10.3724/SP.J.1118.2017.17083
    [23]
    Meusnier I, Singer G A C, Landry J F, et al. 2008. A universal DNA mini-barcode for biodiversity analysis. BMC Genomics, 9: 214. doi: 10.1186/1471-2164-9-214
    [24]
    Miya Masaki, Sato Yukuto, Fukunaga Tsukasa, et al. 2015. Analytical pipeline for DNA sequences amplified by MiFish primers. Biological Journal of the Linnean Society, 73: 259–316
    [25]
    Miya M, Satoh T P, Nishida M. 2005. The phylogenetic position of toadfishes (Order Batrachoidiformes) in the higher ray-finned fish as inferred from partitioned Bayesian analysis of 102 whole mitochondrial genome sequences. Biological Journal of the Linnean Society, 85(3): 289–306. doi: 10.1111/j.1095-8312.2005.00483.x
    [26]
    Miya M, Takeshima H, Endo H, et al. 2003. Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Molecular Phylogenetics and Evolution, 26(1): 121–138. doi: 10.1016/S1055-7903(02)00332-9
    [27]
    Nelson J S, Grande T C, Wilson M V H. 2006. Fishes of the World. 4th ed. New York: John Wiley and Sons, 601
    [28]
    Pfenninger M, Nowak C, Kley C, et al. 2007. Utility of DNA taxonomy and barcoding for the inference of larval community structure in morphologically cryptic Chironomus (Diptera) species. Molecular Ecology, 16(9): 1957–1968. doi: 10.1111/j.1365-294X.2006.03136.x
    [29]
    Puckridge M, Andreakis N, Appleyard S A, et al. 2013. Cryptic diversity in flathead fishes (Scorpaeniformes: Platycephalidae) across the Indo-West Pacific uncovered by DNA barcoding. Molecular Ecology Resources, 13(1): 32–42. doi: 10.1111/1755-0998.12022
    [30]
    Qu Liyan. 2018. Phylogenetic analysis of 28 species of gobies in the East China Sea based on morphology, barcode and nuclear genes (in Chinese) [dissertation]. Shanghai: Shanghai Ocean University
    [31]
    Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4): 406–425
    [32]
    Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: A Laboratory Manual. 2nd ed. Harbor, NY: Cold Spring Harbor Laboratory Press
    [33]
    Shokralla S, Hellberg R S, Handy S M, et al. 2015. A DNA mini-barcoding system for authentication of processed fish products. Scientific Reports, 5: 15894. doi: 10.1038/srep15894
    [34]
    Smith P J, McVeagh S M, Steinke D. 2008. DNA barcoding for the identification of smoked fish products. Journal of Fish Biology, 72(2): 464–471. doi: 10.1111/j.1095-8649.2007.01745.x
    [35]
    Stoeckle M. 2003. Taxonomy, DNA, and the barcode of life. Bioscience, 53(9): 796–797. doi: 10.1641/0006-3568(2003)053[0796:TDATBC]2.0.CO;2
    [36]
    Suh K I, Hwang J M, Bae Y J, et al. 2019. Comprehensive DNA barcodes for species identification and discovery of cryptic diversity in mayfly larvae from South Korea: implications for freshwater ecosystem biomonitoring. Entomological Research, 49(1): 46–54. doi: 10.1111/1748-5967.12334
    [37]
    Sun Yuena, Wang Tao, Jin Xiaoxiao. 2015. Unusual features of control region and a novel NADH 6 genes in mitochondrial genome of the finespot goby, Chaeturichthys stigmatias (Perciformes, Gobiidae). Mitochondrial DNA, 26(5): 665–667. doi: 10.3109/19401736.2013.840598
    [38]
    Sun Peng, Yin Fei, Shi Zhaohong, et al. 2012. Phylogenetic relationships and population structure of Pampus in the South China Sea inferred from COI gene segments. Marine Sciences (in Chinese), 36(6): 15–21
    [39]
    Tamura K, Peterson D, Peterson N, et al. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28(10): 2731–2739. doi: 10.1093/molbev/msr121
    [40]
    Wang Lijuan, Wu Zhihao, Liu Mengxia, et al. 2018. DNA barcoding of marine fish species from Rongcheng Bay, China. PeerJ, 6: e5013. doi: 10.7717/peerj.5013
    [41]
    Ward R D, Holmes B H, Yearsley G K. 2008. DNA barcoding reveals a likely second species of Asian sea bass (barramundi) (Lates calcarifer). Journal of Fish Biology, 72(2): 458–463. doi: 10.1111/j.1095-8649.2007.01703.x
    [42]
    Ward R D, Zemlak T S, Innes B H, et al. 2005. DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences, 360(1462): 1847–1857. doi: 10.1098/rstb.2005.1716
    [43]
    Wu Hanlin, Zhong Junsheng. 2008. Fauna Sinica, Osfichthyes, Perciformes (V), Gobioidei. Beijing: Sdence Press, 211–215
    [44]
    Wyman S K, Jansen R K, Boore J L. 2004. Automatic annotation of organellar genomes with DOGMA. Bioinformatics, 20(17): 3252–3255. doi: 10.1093/bioinformatics/bth352
    [45]
    Xing Bingpeng, Lin Heshan, Zhang Zhilan, et al. 2018. DNA barcoding for identification of fish species in the Taiwan Strait. PLoS One, 13(6): e0198109. doi: 10.1371/journal.pone.0198109
    [46]
    Yu Xin. 2014. Methodology and case studies of fish otolith morphology and microchemistry analysis in stock discrimination (in Chinese) [dissertation]. Qingdao: Institute of Oceanography of Chinese Academy of Sciences
    [47]
    Zemlak T S, Ward R D, Connell A D, et al. 2009. DNA barcoding reveals overlooked marine fishes. Molecular Ecology Resources, 9(S1): 237–242
    • Relative Articles

  • Relative Articles

    • Supplements(0)
    • Cited By

  • Cited by

    Periodical cited type(2)

    1. Shike Gao, Yongqi Yao, Jinchi Wan, et al. Study on seasonal variations of Chaeturichthys stigmatias population resources and its environmental factors in marine ranching areas. Ocean & Coastal Management, 2024, 257: 107305. doi:10.1016/j.ocecoaman.2024.107305
    2. Jiaqiao Wang, Weiyi He, Hao Huang, et al. A Comprehensive Analysis of the Fowleria variegata (Valenciennes, 1832) Mitochondrial Genome and Its Phylogenetic Implications within the Family Apogonidae. Genes, 2023, 14(8): 1612. doi:10.3390/genes14081612

    Other cited types(0)

  • 加载中

Catalog

    通讯作者: 陈斌, bchen63@163.com
    • 1. 

      沈阳化工大学材料科学与工程学院 沈阳 110142

    1. 本站搜索
    2. 百度学术搜索
    3. 万方数据库搜索
    4. CNKI搜索

    Figures(4)  / Tables(5)

    Get Citation
    PDF
    XML

    Article Metrics

    Article views (487) PDF downloads(12) Cited by(2)
    Proportional views
    Related
    Govern Body: China Association for Science and Technology
    Sponsor: Chinese Society for Oceanography
    Tel: 86-10-62179976
    E-mail: ocean2@hyxb.org.cn
    Website: http://www.aosocean.com/
    京ICP备12043220号-7

    Supported by: Beijing Renhe Information Technology Co. Ltd     百度统计

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return